The iSect Toolbox:

The iSect Tools is a collection of the integrated tools in the Genome Express Browser System (GEBrowser) to allow users to manipulate

the genomics database, to retrieve genomic data and sequences, to designed suitable PCR primers and to carry out gene expression

data mining.

1. Preferences: To edit your preference to set your own graphic display and database mining parameters, like image width, zoom factor,
 UTR regions, promoter, data to hide, data to show, display shapes, sizes, colors and track spans and etc. 
  .
 
  
   
   
 
   a. Display: including Track (multiple-track) display and Tiling (Duo-track) display. The Tiling display will ignore
  any histogram or TOME data.
 b. Zoom factor: the base number of a pixel distance in the displayed image map.
 c. Image width: the width of the working area in the displayed image.
 d. Page size: the number of display entries in the function search or the gAtlas display.
 e. UTR5’, UTR3’ and Promoter: the average lengths of UTR5’, UTR3’ and Promoters of genes in the whole 
 genome.
 
2. Search: To open a browser window by querying a gene name, a BAC name, or a data name ( like cDNA, T-DNA or other). 
  Or search the gene annotation or functions. For example:

  a. To search a gene "At1g23450" in Arabidopsis database or "Osp1g00110" in RiceGE, you can select the drowpdown 
 menu of "Type:" as "Gene" and input "At1g23450" or "Osp1g00110" in the "Qurey" field. 
  b.  To query a T-DNA line or cDNA clone, like SALK_000002 or AU075862, you can set the "Type" as "Data", input 
  SALK_000002 or AU075862 in the "Qurey" field. 
  c. Set the "Type" as "Function" to query genes which annotations contain your input keywords, like auxin. 
 
  
 
3. Locate: To open browser window by positioning its location (chromosome and position).
 
  
 
4. Fetch: To retrieve all displayed data entries from a chromosome region. For example: 1234-2345 or W/1234-2345.
 
  
 
5. mText: Multiple-gene or multiple T-DNA/cDNA search to allow retrieving data or genes related a list of genes/T-DNAs/cDNAs. For example: 
 
 Osp1g00110
 Osm1g00640
 
  
 
 
6. iSectR:  iSect (R) tool to retrieve a fragments of sequences (sequences in a specific chromosome region) from the pseudo-molecules
 
 For example: chr01 [chromosome] and 1234-2345 or 1234-2345,3456-4567 [Range or Coordinates].
 
7. iSectL: iSect (L) tool to retrieve a fragments of sequences from the genome corresponding to the mapping coordinates of a list of 
existed data names in the database or a new created genome mapping list. 

 For example:
 
 Osp1g00110
 AU075862
 PFG_3A-08906.R
 
 or
 
 query1 chloroplast 0.0 W/1234-2345
 search2 chr01 0.0 C/1234-2345,3456-4567
 
  
 
 
8. PrimerL: iSect primer (L) tool to design primers for a list of data names existed or a list of genome mapping data. It includes actually
 two steps: first to retrieve the genome sequences by Primer3.iSect tool and then design primers by the Primer3.
 
  a. Protocol to design primer pair for insertion.
 
  
 
  b. Protocol to design primer pair for target region or deletion.
  
 
 For example:
 
  Osp1g00110
  AU075862
   PFG_3A-08906.R
 
  or
 
  query1 chloroplast 0.0 W/1234-2345
  search2 chr01 0.0 C/1234-2345,3456-4567
 
 
  
 
9. PrimerS: iSect primer (S) tool to design primers from user input sequences. 
 
 For example:
 
  >YourInput.fa
  CTCGCTGGCCTGTTCAGGTGAATCTTAGTATCGTTTTGTGTCCATGTTGCCTCTACTTCG
  CCTGCTTCTGGTGACTTGAATTCTCTCTTTGTTTTGGGCAGCTTCGGGAACCTTCCACAT
  CCGAAGATGCTGAATTCGCTTCTATTTTGCGGACTCTCAAGGACAGTTTTGATAACGCAT
  TCACTGCTATGATTTCCTTCCAGACGAAGAATTCCGAGCGCATATTCAGCACAGGTATAA
 
 
 
10. GeneAtlas: Gene express atlas query tool by probe name or gene name. 
 
 For example:
 
  Query: You can select an expression Data type, which is usually different in array type or platform
 like GPL2025 [Data Type], and then input probe set or gene name, like AFFX-BioB-3_at or 
 Os01g01100 in the Query field. 
  RMOS [Data Type] 001-200-E04 or Os07g04850 
  Filter:  You can input words to select the experiments which contain your keywords. For example: 
 GSE7951 GSE7952 or root Seedling ABA (allow maximum 5 words).
  PageSize: Number of the display samples in a page.